|
miRBase |
|
Stem-loop sequence hsa-mir-3119-1 |
||||||
| Accession | MI0014134 | |||||
| Description | Homo sapiens miR-3119-1 stem-loop | |||||
| Gene family | MIPF0000971; mir-3119 | |||||
| Stem-loop |
c g cua
auuaacu uggcuuuuaacuuugauggcaaagg guag a
||||||| ||||||||||||||||||||||||| |||| a
uaauuga accgaaaauugaaacuaccguuucu uauc c
u g uaa
|
|||||
| Deep sequencing |
| |||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links |
|
|||||
Mature sequence hsa-miR-3119 |
|
| Accession | MIMAT0014981 |
| Sequence |
9 - uggcuuuuaacuuugauggc - 28 |
| Deep sequencing | 11 reads, 3 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|