Stem-loop sequence hsa-mir-3118-3

Accession MI0014133
Description Homo sapiens miR-3118-3 stem-loop
Gene family MIPF0000837; mir-3118
Stem-loop 
          u               a     caua 
cacacuacaa aauuuucauaaugca ucaca    a
|||||||||| ||||||||||||||| |||||    u
gugugauguu uuaaaaguauuacgu agugu    c
          c               c     auca
Get sequence
Deep sequencing
9 reads, 3 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 143424141-143424215 [-]
sense
OTTHUMT00000037552 ; BX004987.4-002; intron 1
OTTHUMT00000037552 ; BX004987.4-002; intron 1
OTTHUMT00000037552 ; BX004987.4-002; intron 1
OTTHUMT00000037553 ; BX004987.4-003; intron 2
OTTHUMT00000037551 ; BX004987.4-001; intron 2
OTTHUMT00000037554 ; BX004987.4-004; intron 2
OTTHUMT00000037553 ; BX004987.4-003; intron 2
OTTHUMT00000037551 ; BX004987.4-001; intron 2
OTTHUMT00000037554 ; BX004987.4-004; intron 2
OTTHUMT00000037553 ; BX004987.4-003; intron 2
OTTHUMT00000037551 ; BX004987.4-001; intron 2
OTTHUMT00000037554 ; BX004987.4-004; intron 2
OTTHUMT00000037558 ; BX004987.4-008; intron 4
OTTHUMT00000037558 ; BX004987.4-008; intron 4
OTTHUMT00000037558 ; BX004987.4-008; intron 4
ENST00000423249 ; BX004987.4-002; intron 1
ENST00000423249 ; BX004987.4-002; intron 1
ENST00000423249 ; BX004987.4-002; intron 1
ENST00000443548 ; BX004987.4-003; intron 2
ENST00000424068 ; BX004987.4-001; intron 2
ENST00000432361 ; BX004987.4-004; intron 2
ENST00000443548 ; BX004987.4-003; intron 2
ENST00000424068 ; BX004987.4-001; intron 2
ENST00000432361 ; BX004987.4-004; intron 2
ENST00000443548 ; BX004987.4-003; intron 2
ENST00000424068 ; BX004987.4-001; intron 2
ENST00000432361 ; BX004987.4-004; intron 2
ENST00000443766 ; BX004987.4-008; intron 4
ENST00000443766 ; BX004987.4-008; intron 4
ENST00000443766 ; BX004987.4-008; intron 4
Database links

Mature sequence hsa-miR-3118

Accession MIMAT0014980
Sequence

44 -  

ugugacugcauuaugaaaauucu

 - 66

Get sequence
Deep sequencing 54 reads, 3 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).