Stem-loop sequence hsa-mir-3117

Accession MI0014130
Description Homo sapiens miR-3117 stem-loop
Gene family MIPF0001506; mir-3117
Stem-loop 
   -     g   a a       c     a     ggg 
ccc uaaag gcc g cacuaua gaguc uauaa   a
||| ||||| ||| | ||||||| ||||| |||||   a
ggg guuuu ugg c gugauau cucag auauu   g
   u     g   a c       a     g     acg
Get sequence
Deep sequencing
41 reads, 4 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 67094123-67094200 [+]
sense
OTTHUMT00000100224 ; SGIP1-010; intron 1
OTTHUMT00000100224 ; SGIP1-010; intron 1
OTTHUMT00000100224 ; SGIP1-010; intron 1
OTTHUMT00000100221 ; SGIP1-007; intron 2
OTTHUMT00000025395 ; SGIP1-001; intron 2
OTTHUMT00000100221 ; SGIP1-007; intron 2
OTTHUMT00000025395 ; SGIP1-001; intron 2
OTTHUMT00000100221 ; SGIP1-007; intron 2
OTTHUMT00000025395 ; SGIP1-001; intron 2
OTTHUMT00000025396 ; SGIP1-002; intron 3
OTTHUMT00000025397 ; SGIP1-003; intron 3
OTTHUMT00000100220 ; SGIP1-006; intron 3
OTTHUMT00000025396 ; SGIP1-002; intron 3
OTTHUMT00000025397 ; SGIP1-003; intron 3
OTTHUMT00000100220 ; SGIP1-006; intron 3
OTTHUMT00000025396 ; SGIP1-002; intron 3
OTTHUMT00000025397 ; SGIP1-003; intron 3
OTTHUMT00000100220 ; SGIP1-006; intron 3
ENST00000483060 ; SGIP1-010; intron 1
ENST00000483060 ; SGIP1-010; intron 1
ENST00000483060 ; SGIP1-010; intron 1
ENST00000468286 ; SGIP1-007; intron 2
ENST00000371037 ; SGIP1-001; intron 2
ENST00000371035 ; SGIP1-201; intron 2
ENST00000371038 ; SGIP1-203; intron 2
ENST00000407289 ; SGIP1-204; intron 2
ENST00000371036 ; SGIP1-202; intron 2
ENST00000468286 ; SGIP1-007; intron 2
ENST00000371037 ; SGIP1-001; intron 2
ENST00000371035 ; SGIP1-201; intron 2
ENST00000371038 ; SGIP1-203; intron 2
ENST00000407289 ; SGIP1-204; intron 2
ENST00000371036 ; SGIP1-202; intron 2
ENST00000468286 ; SGIP1-007; intron 2
ENST00000371037 ; SGIP1-001; intron 2
ENST00000371035 ; SGIP1-201; intron 2
ENST00000371036 ; SGIP1-202; intron 2
ENST00000237247 ; SGIP1-002; intron 3
ENST00000371039 ; SGIP1-003; intron 3
ENST00000424320 ; SGIP1-006; intron 3
ENST00000237247 ; SGIP1-002; intron 3
ENST00000371039 ; SGIP1-003; intron 3
ENST00000424320 ; SGIP1-006; intron 3
ENST00000237247 ; SGIP1-002; intron 3
ENST00000371039 ; SGIP1-003; intron 3
ENST00000424320 ; SGIP1-006; intron 3
Database links

Mature sequence hsa-miR-3117-5p

Accession MIMAT0019197
Sequence

13 -  

agacacuauacgagucauau

 - 32

Get sequence
Evidence experimental; Solexa [2-3]
Predicted targets

Mature sequence hsa-miR-3117-3p

Accession MIMAT0014979
Previous IDs hsa-miR-3117
Sequence

46 -  

auaggacucauauagugccag

 - 66

Get sequence
Deep sequencing 40 reads, 3 experiments
Evidence experimental; Solexa [1-3]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Moqadam FA, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).