Stem-loop sequence hsa-mir-3116-2

AccessionMI0014129 (change log)
Symbol HGNC:MIR3116-2
DescriptionHomo sapiens miR-3116-2 stem-loop
Gene family MIPF0001002; mir-3116
Literature search

1 open access papers mention hsa-mir-3116-2
(1 sentences)

Stem-loop
                               cuacg 
5' uauugagucccuacuauguuccaggcac     a
   ||||||||||||||||||||||||||||      
3' auaacucagggaugauacaagguccgug     u
                               accca 
Get sequence
Deep sequencing
226 reads, 0 reads per million, 71 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 62078789-62078856 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-3116-2
hsa-mir-3116-2chr1: 62078789-62078856 [-]
hsa-mir-3116-1chr1: 62078786-62078859 [+]
Database links

Mature sequence hsa-miR-3116

Accession MIMAT0014978
Sequence

42 - 

ugccuggaacauaguagggacu

 - 63

Get sequence
Deep sequencing303 reads, 56 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).