Stem-loop sequence hsa-mir-3116-1

Accession MI0014128
Description Homo sapiens miR-3116-1 stem-loop
Gene family MIPF0001002; mir-3116
Stem-loop 
                                gggu 
cuuuauugagucccuacuauguuccaggcacu    a
||||||||||||||||||||||||||||||||     
gaaauaacucagggaugauacaagguccgugg    u
                                augc
Get sequence
Deep sequencing
7 reads, 3 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 62544458-62544531 [+]
sense
OTTHUMT00000024680 ; INADL-008; intron 5
OTTHUMT00000024680 ; INADL-008; intron 5
OTTHUMT00000024680 ; INADL-008; intron 5
OTTHUMT00000023643 ; INADL-005; intron 19
OTTHUMT00000023643 ; INADL-005; intron 19
OTTHUMT00000023643 ; INADL-005; intron 19
OTTHUMT00000023639 ; INADL-001; intron 31
OTTHUMT00000023640 ; INADL-002; intron 31
OTTHUMT00000023641 ; INADL-003; intron 31
OTTHUMT00000023642 ; INADL-004; intron 31
OTTHUMT00000023639 ; INADL-001; intron 31
OTTHUMT00000023640 ; INADL-002; intron 31
OTTHUMT00000023641 ; INADL-003; intron 31
OTTHUMT00000023642 ; INADL-004; intron 31
OTTHUMT00000023639 ; INADL-001; intron 31
OTTHUMT00000023640 ; INADL-002; intron 31
OTTHUMT00000023641 ; INADL-003; intron 31
OTTHUMT00000023642 ; INADL-004; intron 31
ENST00000545929 ; INADL-205; intron 4
ENST00000545929 ; INADL-205; intron 4
ENST00000545929 ; INADL-202; intron 4
ENST00000307297 ; INADL-008; intron 5
ENST00000543708 ; INADL-204; intron 5
ENST00000307297 ; INADL-008; intron 5
ENST00000543708 ; INADL-204; intron 5
ENST00000307297 ; INADL-008; intron 5
ENST00000543708 ; INADL-201; intron 5
ENST00000484937 ; INADL-005; intron 19
ENST00000484937 ; INADL-005; intron 19
ENST00000484937 ; INADL-005; intron 19
ENST00000255202 ; INADL-201; intron 26
ENST00000255202 ; INADL-201; intron 26
ENST00000371158 ; INADL-001; intron 31
ENST00000484562 ; INADL-002; intron 31
ENST00000316485 ; INADL-003; intron 31
ENST00000459752 ; INADL-004; intron 31
ENST00000371156 ; INADL-202; intron 31
ENST00000395513 ; INADL-203; intron 31
ENST00000371158 ; INADL-001; intron 31
ENST00000484562 ; INADL-002; intron 31
ENST00000316485 ; INADL-003; intron 31
ENST00000459752 ; INADL-004; intron 31
ENST00000371156 ; INADL-202; intron 31
ENST00000395513 ; INADL-203; intron 31
ENST00000371158 ; INADL-001; intron 31
ENST00000484562 ; INADL-002; intron 31
ENST00000316485 ; INADL-003; intron 31
ENST00000459752 ; INADL-004; intron 31
Clustered miRNAs
< 10kb from hsa-mir-3116-1
hsa-mir-3116-1 chr1: 62544458-62544531 [+]
hsa-mir-3116-2 chr1: 62544461-62544528 [-]
Database links

Mature sequence hsa-miR-3116

Accession MIMAT0014978
Sequence

45 -  

ugccuggaacauaguagggacu

 - 66

Get sequence
Deep sequencing 14 reads, 3 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).