Stem-loop sequence hsa-mir-3115

Accession MI0014127
Description Homo sapiens miR-3115 stem-loop
Stem-loop 
    a    --       c         ----   a 
ucug auau  ggguuua uaguuggug    gug a
|||| ||||  ||||||| |||||||||    |||  
agac ugua  uccggau aucaaccgc    uac u
    c    uu       u         ugag   u
Get sequence
Deep sequencing
5 reads, 2 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 23370798-23370865 [+]
sense
OTTHUMT00000008880 ; KDM1A-001; intron 2
OTTHUMT00000008881 ; KDM1A-002; intron 2
OTTHUMT00000008880 ; KDM1A-001; intron 2
OTTHUMT00000008881 ; KDM1A-002; intron 2
OTTHUMT00000008880 ; KDM1A-001; intron 2
OTTHUMT00000008881 ; KDM1A-002; intron 2
ENST00000356634 ; KDM1A-001; intron 2
ENST00000400181 ; KDM1A-002; intron 2
ENST00000542151 ; KDM1A-201; intron 2
ENST00000356634 ; KDM1A-001; intron 2
ENST00000400181 ; KDM1A-002; intron 2
ENST00000542151 ; KDM1A-201; intron 2
ENST00000356634 ; KDM1A-001; intron 2
ENST00000400181 ; KDM1A-002; intron 2
ENST00000542151 ; KDM1A-201; intron 2
antisense
OTTHUMT00000008884 ; RP1-184J9.2-001; intron 1
OTTHUMT00000008884 ; RP1-184J9.2-001; intron 1
OTTHUMT00000008884 ; RP1-184J9.2-001; intron 1
ENST00000427154 ; RP1-184J9.2-001; intron 1
ENST00000427154 ; RP1-184J9.2-001; intron 1
ENST00000427154 ; RP1-184J9.2-001; intron 1
Database links

Mature sequence hsa-miR-3115

Accession MIMAT0014977
Sequence

6 -  

auauggguuuacuaguuggu

 - 25

Get sequence
Deep sequencing 5 reads, 2 experiments
Evidence experimental; Solexa [1-2]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).