Stem-loop sequence oar-mir-181a-1

AccessionMI0014123 (change log)
DescriptionOvis aries miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

4 open access papers mention oar-mir-181a-1
(8 sentences)

Stem-loop
   ---u   cuuc a     -  uc  u a   u      cu       a    g  auu 
5'     gag    g gguug cu  ag g aca ucaacg  gucggug guuu ga   a
       |||    | ||||| ||  || | ||| ||||||  ||||||| |||| ||    
3'     cuc    c ccaac gg  uc c ugu aguugc  cagcuac caaa cu   a
   ccac   -uac a     c  ua  c a   u      --       -    a  aaa 
Get sequence
Deep sequencing
52747 reads, 7.93e+03 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr12: 75782750-75782859 [-]
intergenic
Database links

Mature sequence oar-miR-181a

Accession MIMAT0014973
Sequence

24 - 

aacauucaacgcugucggugagu

 - 46

Get sequence
Deep sequencing103330 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:20140706 "Characterization of microRNAs from sheep (Ovis aries) using computational and experimental analyses" Sheng X, Song X, Yu Y, Niu L, Li S, Li H, Wei C, Liu T, Zhang L, Du L Mol Biol Rep. 38:3161-3171(2011).