Stem-loop sequence oar-mir-133

AccessionMI0014122 (change log)
DescriptionOvis aries miR-133 stem-loop
Gene family MIPF0000029; mir-133
Literature search

11 open access papers mention oar-mir-133
(38 sentences)

Stem-loop
   gggaccg     uuu    a       aa  u  a        aacug 
5'        aaugc   gcua agcuggu  aa gg accaaauc     u
          |||||   |||| |||||||  || || ||||||||      
3'        uuacg   cgau ucgacca  uu cc ugguuuag     u
   ----uag     cgu    g       ac  c  c        guagc 
Get sequence
Deep sequencing
4308 reads, 685 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr13: 53961752-53961845 [-]
intergenic
Database links

Mature sequence oar-miR-133

Accession MIMAT0014972
Sequence

59 - 

uugguccccuucaaccagcugu

 - 80

Get sequence
Deep sequencing3936 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:20140706 "Characterization of microRNAs from sheep (Ovis aries) using computational and experimental analyses" Sheng X, Song X, Yu Y, Niu L, Li S, Li H, Wei C, Liu T, Zhang L, Du L Mol Biol Rep. 38:3161-3171(2011).