Stem-loop sequence oar-mir-125b

AccessionMI0014121 (change log)
DescriptionOvis aries miR-125b stem-loop
Gene family MIPF0000033; mir-10
Literature search

8 open access papers mention oar-mir-125b
(12 sentences)

Stem-loop
   c     c   u  -a    u    c           au     c 
5'  gcgcg cuc ca  uccc gaga ccuaacuugug  guuua c
    ||||| ||| ||  |||| |||| |||||||||||  ||||| g
3'  cgcgc gag gu  aggg uucu ggauugggcac  uaaau u
   c     u   c  cg    -    c           -c     u 
Get sequence
Deep sequencing
397908 reads, 6.68e+04 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr15: 32240520-32240607 [-]
intergenic
Database links

Mature sequence oar-miR-125b

Accession MIMAT0014971
Sequence

15 - 

ucccugagacccuaacuugug

 - 35

Get sequence
Deep sequencing397869 reads, 13 experiments
Evidence experimental; cloned [1-2]

References

1
PMID:20140706 "Characterization of microRNAs from sheep (Ovis aries) using computational and experimental analyses" Sheng X, Song X, Yu Y, Niu L, Li S, Li H, Wei C, Liu T, Zhang L, Du L Mol Biol Rep. 38:3161-3171(2011).
2
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).