Stem-loop sequence oar-mir-29a

AccessionMI0014117 (change log)
DescriptionOvis aries miR-29a stem-loop
Gene family MIPF0000009; mir-29
Literature search

4 open access papers mention oar-mir-29a
(24 sentences)

Stem-loop
               uuu       c    ucaa 
5' augacugauuuc   ugguguu agag    u
   ||||||||||||   ||||||| ||||    a
3' uauuggcuaaag   accacga ucuu    u
               ucu       -    uuaa 
Get sequence
Deep sequencing
66028 reads, 1.2e+04 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr4: 94606485-94606548 [-]
sense
ENSOART00000026159 ; oar-mir-29a-201; exon 1
Database links

Mature sequence oar-miR-29a

Accession MIMAT0014967
Sequence

42 - 

uagcaccaucugaaaucgguu

 - 62

Get sequence
Deep sequencing65471 reads, 13 experiments
Evidence experimental; cloned [1-2]

References

1
PMID:20140706 "Characterization of microRNAs from sheep (Ovis aries) using computational and experimental analyses" Sheng X, Song X, Yu Y, Niu L, Li S, Li H, Wei C, Liu T, Zhang L, Du L Mol Biol Rep. 38:3161-3171(2011).
2
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).