Stem-loop sequence oar-mir-21

AccessionMI0014116 (change log)
DescriptionOvis aries miR-21 stem-loop
Gene family MIPF0000060; mir-21
Literature search

10 open access papers mention oar-mir-21
(42 sentences)

Stem-loop
   u     gu        a     a     a    u a 
5'  gucgg  agcuuauc gacug uguug cugu g a
    |||||  |||||||| ||||| ||||| |||| | u
3'  caguc  ucggguag cugac acaac ggua c c
   a     ug        -     g     -    - u 
Get sequence
Deep sequencing
357390 reads, 6.3e+04 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr11: 10336498-10336569 [+]
intergenic
Database links

Mature sequence oar-miR-21

Accession MIMAT0014966
Sequence

8 - 

uagcuuaucagacugauguugac

 - 30

Get sequence
Deep sequencing357212 reads, 13 experiments
Evidence experimental; cloned [1-2]

References

1
PMID:20140706 "Characterization of microRNAs from sheep (Ovis aries) using computational and experimental analyses" Sheng X, Song X, Yu Y, Niu L, Li S, Li H, Wei C, Liu T, Zhang L, Du L Mol Biol Rep. 38:3161-3171(2011).
2
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).