Stem-loop sequence mmu-mir-1912

AccessionMI0014110 (change log)
Symbol MGI:Mir1912
DescriptionMus musculus miR-1912 stem-loop
Gene family MIPF0000768; mir-1912
Literature search

4 open access papers mention mmu-mir-1912
(5 sentences)

Stem-loop
   u         ggau  g           gg       gauuu 
5'  uagucucua    gu cucauugcaug  cugugua     u
    |||||||||    || |||||||||||  |||||||     u
3'  guuagagau    ca gagugacguac  gacacau     a
   g         aguu  a           aa       aauuu 
Get sequence
Deep sequencing
106 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 147009441-147009527 [+]
sense
OTTMUST00000045550 ; Htr2c-004; intron 2
OTTMUST00000045548 ; Htr2c-002; intron 2
OTTMUST00000045549 ; Htr2c-003; intron 2
OTTMUST00000045553 ; Htr2c-007; intron 2
OTTMUST00000045552 ; Htr2c-006; intron 2
OTTMUST00000045515 ; Htr2c-001; intron 3
ENSMUST00000112831 ; Htr2c-006; intron 2
ENSMUST00000134368 ; Htr2c-007; intron 2
ENSMUST00000156697 ; Htr2c-003; intron 2
ENSMUST00000036303 ; Htr2c-002; intron 2
ENSMUST00000131999 ; Htr2c-004; intron 2
ENSMUST00000096299 ; Htr2c-001; intron 3
Clustered miRNAs
< 10kb from mmu-mir-1912
mmu-mir-764chrX: 147002259-147002366 [+]
mmu-mir-1912chrX: 147009441-147009527 [+]
mmu-mir-1264chrX: 147010601-147010686 [+]
Database links

Mature sequence mmu-miR-1912-5p

Accession MIMAT0014957
Previous IDsmmu-miR-1912*
Sequence

16 - 

ugcucauugcaugggcugugua

 - 37

Get sequence
Deep sequencing21 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-1912-3p

Accession MIMAT0014958
Previous IDsmmu-miR-1912
Sequence

53 - 

cacagaacaugcagugagaacu

 - 74

Get sequence
Deep sequencing83 reads, 16 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).