Stem-loop sequence mmu-mir-374c

AccessionMI0014108 (change log)
Symbol MGI:Mir374c
DescriptionMus musculus miR-374c stem-loop
Gene family MIPF0000288; mir-374
Literature search

14 open access papers mention mmu-mir-374c
(40 sentences)

Stem-loop
   -g                    cu 
5'   auaauacaaccugcuaagug  a
     ||||||||||||||||||||   
3'   uauuauguuggacgauucac  g
   ua                    aa 
Get sequence
Deep sequencing
3370 reads, 3.16 reads per million, 95 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 103573085-103573133 [+]
antisense
OTTMUST00000044290 ; Thcytx-002; intron 9
OTTMUST00000044291 ; Thcytx-003; intron 10
OTTMUST00000044293 ; Thcytx-005; intron 10
OTTMUST00000044239 ; Thcytx-001; intron 10
ENSMUST00000102314 ; Mir374-201; exon 1
ENSMUST00000130063 ; Ftx-002; intron 9
ENSMUST00000156211 ; Ftx-001; intron 10
ENSMUST00000145803 ; Ftx-005; intron 10
ENSMUST00000156240 ; Ftx-003; intron 10
Clustered miRNAs
< 10kb from mmu-mir-374c
mmu-mir-421chrX: 103572921-103572996 [-]
mmu-mir-374bchrX: 103573060-103573154 [-]
mmu-mir-374cchrX: 103573085-103573133 [+]
Database links

Mature sequence mmu-miR-374c-5p

Accession MIMAT0014953
Previous IDsmmu-miR-374c
Sequence

2 - 

auaauacaaccugcuaagug

 - 21

Get sequence
Deep sequencing888 reads, 74 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-374c-3p

Accession MIMAT0014954
Previous IDsmmu-miR-374c*
Sequence

29 - 

acuuagcagguuguauuau

 - 47

Get sequence
Deep sequencing2481 reads, 86 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).