Stem-loop sequence mmu-mir-3108

AccessionMI0014105 (change log)
Symbol MGI:Mir3108
DescriptionMus musculus miR-3108 stem-loop
Literature search

1 open access papers mention mmu-mir-3108
(1 sentences)

Stem-loop
      aa  -a   u     a g       uu      a uu 
5' cac  cc  ggg cucua a cuagacg  ccggag a  u
   |||  ||  ||| ||||| | |||||||  |||||| |   
3' gug  gg  cuc gagau u gaucugc  ggcuuu u  u
      aa  aa   u     c g       --      a uu 
Get sequence
Deep sequencing
184 reads, 50.9 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 108936860-108936938 [+]
sense
OTTMUST00000107189 ; Zfhx3-001; intron 7
ENSMUST00000043896 ; Zfhx3-001; intron 7
Database links

Mature sequence mmu-miR-3108-5p

Accession MIMAT0014947
Previous IDsmmu-miR-3108
Sequence

11 - 

gucucuaaagcuagacguuccgg

 - 33

Get sequence
Deep sequencing138 reads, 46 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3108-3p

Accession MIMAT0014948
Previous IDsmmu-miR-3108*
Sequence

52 - 

cgucuaggucuagagucucaa

 - 72

Get sequence
Deep sequencing8 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).