Stem-loop sequence mmu-mir-344f

AccessionMI0014098 (change log)
Symbol MGI:Mir344f
DescriptionMus musculus miR-344f stem-loop
Gene family MIPF0000267; mir-344
Literature search

10 open access papers mention mmu-mir-344f
(33 sentences)

Stem-loop
   --cc      uc             ------     u 
5'     agucag  uccuggcuggagu      ccagc c
       ||||||  |||||||||||||      ||||| u
3'     ucaguc  aggaccgaucucg      ggucg a
   aaca      -c             gaccuu     a 
Get sequence
Deep sequencing
450 reads, 12.5 reads per million, 24 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 62046181-62046248 [-]
intergenic
Database links

Mature sequence mmu-miR-344f-5p

Accession MIMAT0014931
Sequence

3 - 

agucagucuccuggcuggaguc

 - 24

Get sequence
Deep sequencing275 reads, 20 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-344f-3p

Accession MIMAT0014932
Sequence

46 - 

cucuagccaggaccugacuac

 - 66

Get sequence
Deep sequencing175 reads, 17 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).