Stem-loop sequence mmu-mir-344g

AccessionMI0014097 (change log)
Symbol MGI:Mir344g
DescriptionMus musculus miR-344g stem-loop
Gene family MIPF0000267; mir-344
Literature search

9 open access papers mention mmu-mir-344g
(32 sentences)

Stem-loop
   -   c               a    u    cuc  a 
5'  ugc agucaggcuccuggc ggag ccug   uc g
    ||| ||||||||||||||| |||| ||||   ||  
3'  acg ucaguucggggaccg ucuc ggac   gg c
   a   -               a    -    cuu  u 
Get sequence
Deep sequencing
122 reads, 243 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 61982289-61982359 [-]
sense
ENSMUST00000181187 ; A330076H08Rik-202; exon 1
ENSMUST00000180481 ; A330076H08Rik-201; exon 1
ENSMUST00000181804 ; A330076H08Rik-203; exon 1
Database links

Mature sequence mmu-miR-344g-5p

Accession MIMAT0014929
Sequence

5 - 

agucaggcuccuggcaggagu

 - 25

Get sequence
Deep sequencing64 reads, 8 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-344g-3p

Accession MIMAT0014930
Sequence

44 - 

caggcucuagccaggggcuuga

 - 65

Get sequence
Deep sequencing56 reads, 19 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).