Stem-loop sequence mmu-mir-344c

AccessionMI0014096 (change log)
Symbol MGI:Mir344c
DescriptionMus musculus miR-344c stem-loop
Gene family MIPF0000267; mir-344
Literature search

9 open access papers mention mmu-mir-344c
(109 sentences)

Stem-loop
   cugcaa  -  uu   uca        gc        ----    -   u 
5'       gg gu  uuu   gucaggcu  uggcuaga    guac agc a
         || ||  |||   ||||||||  ||||||||    |||| ||| u
3'       cc cg  aaa   caguccga  acugaucu    caug ucg c
   ----ga  u  uc   uga        -a        aguc    g   a 
Get sequence
Deep sequencing
17768 reads, 88.7 reads per million, 53 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 61837311-61837402 [-]
intergenic
Database links

Mature sequence mmu-miR-344c-5p

Accession MIMAT0014927
Previous IDsmmu-miR-344c*
Sequence

18 - 

agucaggcugcuggcuagaguac

 - 40

Get sequence
Deep sequencing19 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-344c-3p

Accession MIMAT0014928
Previous IDsmmu-miR-344c
Sequence

58 - 

ugaucuagucaaagccugacagu

 - 80

Get sequence
Deep sequencing17745 reads, 52 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).