Stem-loop sequence mmu-mir-344b

AccessionMI0014095 (change log)
Symbol MGI:Mir344b
DescriptionMus musculus miR-344b stem-loop
Gene family MIPF0000267; mir-344
Literature search

10 open access papers mention mmu-mir-344b
(106 sentences)

Stem-loop
   --au          cc        guu    u 
5'     cagucaggcu  uggcuaaa   cagc u
       ||||||||||  ||||||||   |||| u
3'     gucaguccga  accgauuu   gucg c
   gaau          -a        -ac    a 
Get sequence
Deep sequencing
2334 reads, 0 reads per million, 37 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 61790519-61790581 [-]
intergenic
Database links

Mature sequence mmu-miR-344b-5p

Accession MIMAT0014925
Previous IDsmmu-miR-344b*
Sequence

4 - 

agucaggcuccuggcuaaaguuc

 - 26

Get sequence
Deep sequencing13 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-344b-3p

Accession MIMAT0014926
Previous IDsmmu-miR-344b
Sequence

39 - 

cauuuagccaaagccugacugu

 - 60

Get sequence
Deep sequencing2321 reads, 37 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).