Stem-loop sequence mmu-mir-344e

AccessionMI0014094 (change log)
Symbol MGI:Mir344e
DescriptionMus musculus miR-344e stem-loop
Gene family MIPF0000267; mir-344
Literature search

10 open access papers mention mmu-mir-344e
(34 sentences)

Stem-loop
   ---c          c   c     u        u 
5'     agucaggcuu ugg uauau ccaggacu a
       |||||||||| ||| ||||| |||||||| c
3'     ucaguccgaa acc auaua gguccugg c
   uaua          -   a     -        u 
Get sequence
Deep sequencing
59 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 61735537-61735602 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-344e
mmu-mir-344h-2chr7: 61742366-61742425 [-]
mmu-mir-344h-1chr7: 61739350-61739409 [-]
mmu-mir-344echr7: 61735537-61735602 [-]
mmu-mir-344d-3chr7: 61726249-61726328 [-]
Database links

Mature sequence mmu-miR-344e-5p

Accession MIMAT0014923
Previous IDsmmu-miR-344e*
Sequence

5 - 

caggcuucuggcuauauucc

 - 24

Get sequence
Deep sequencing22 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-344e-3p

Accession MIMAT0014924
Previous IDsmmu-miR-344e
Sequence

43 - 

gauauaaccaaagccugacuau

 - 64

Get sequence
Deep sequencing37 reads, 13 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).