Stem-loop sequence mmu-mir-3095

AccessionMI0014088 (change log)
Symbol MGI:Mir3095
DescriptionMus musculus miR-3095 stem-loop
Literature search

2 open access papers mention mmu-mir-3095
(2 sentences)

Stem-loop
       ccug    c          a   -   -a     -ga  u 
5' gagc    ugca aagcuuucuc ucu gug  cacuc   ga g
   ||||    |||| |||||||||| ||| |||  |||||   || g
3' cucg    acgu uucgagagag agg cac  gugag   cu u
       cuga    u          -   u   ag     gga  u 
Get sequence
Deep sequencing
3658 reads, 780 reads per million, 90 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 58441012-58441098 [-]
sense
OTTMUST00000017342 ; Lpar1-005; intron 2
OTTMUST00000017338 ; Lpar1-001; intron 3
OTTMUST00000017339 ; Lpar1-002; intron 3
OTTMUST00000017340 ; Lpar1-003; intron 3
OTTMUST00000017341 ; Lpar1-004; intron 3
ENSMUST00000107570 ; Lpar1-005; intron 2
ENSMUST00000055018 ; Lpar1-001; intron 3
ENSMUST00000107571 ; Lpar1-002; intron 3
ENSMUST00000107575 ; Lpar1-003; intron 3
ENSMUST00000107574 ; Lpar1-004; intron 3
Database links

Mature sequence mmu-miR-3095-5p

Accession MIMAT0014911
Sequence

14 - 

aagcuuucucaucugugacacu

 - 35

Get sequence
Deep sequencing79 reads, 24 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3095-3p

Accession MIMAT0014912
Sequence

54 - 

uggacacuggagagagagcuuuu

 - 76

Get sequence
Deep sequencing3576 reads, 87 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).