Stem-loop sequence mmu-mir-3088

AccessionMI0014081 (change log)
Symbol MGI:Mir3088
DescriptionMus musculus miR-3088 stem-loop
Stem-loop
   ------   ug   gcua                 u  ggc 
5'       cag  ccu    ugcaguuguucaugagc cu   u
         |||  |||    ||||||||||||||||| ||    
3'       guu  gga    acgucgacgaguacuug ga   c
   gucguc   gu   ---a                 -  agc 
Get sequence
Deep sequencing
152 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 28733278-28733351 [+]
sense
OTTMUST00000027604 ; Ak8-001; intron 5
OTTMUST00000027605 ; Ak8-002; intron 6
ENSMUST00000074156 ; Ak8-001; intron 5
ENSMUST00000123794 ; Ak8-002; intron 6
Database links

Mature sequence mmu-miR-3088-5p

Accession MIMAT0014897
Previous IDsmmu-miR-3088*
Sequence

9 - 

gcuaugcaguuguucaugagcu

 - 30

Get sequence
Deep sequencing13 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-3088-3p

Accession MIMAT0014898
Previous IDsmmu-miR-3088
Sequence

44 - 

uucaugagcagcugcaaaggugu

 - 66

Get sequence
Deep sequencing137 reads, 36 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).