Stem-loop sequence mmu-mir-466n

AccessionMI0014079 (change log)
Symbol MGI:Mir466n
DescriptionMus musculus miR-466n stem-loop
Gene family MIPF0000316; mir-467
Literature search

22 open access papers mention mmu-mir-466n
(56 sentences)

Stem-loop
                             gua      c        au 
5' guaugugcauguguguuugugugugc   caugua augugugu  a
   ||||||||||||||||||||||||||   |||||| ||||||||   
3' cguguacgugcacacagauacauacg   guacau uacguaua  u
                             aga      a        ag 
Get sequence
Deep sequencing
2440 reads, 24.7 reads per million, 93 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10513741-10513834 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-466n
mmu-mir-669a-12chr2: 10503791-10503877 [+]
mmu-mir-467echr2: 10505721-10505807 [+]
mmu-mir-466pchr2: 10506006-10506094 [+]
mmu-mir-467dchr2: 10507630-10507714 [+]
mmu-mir-466achr2: 10507918-10507990 [+]
mmu-mir-297cchr2: 10509016-10509113 [+]
mmu-mir-669cchr2: 10509296-10509404 [+]
mmu-mir-669a-2chr2: 10510164-10510260 [+]
mmu-mir-297bchr2: 10511667-10511775 [+]
mmu-mir-466dchr2: 10511967-10512062 [+]
mmu-mir-669m-1chr2: 10512790-10512887 [+]
mmu-mir-669m-2chr2: 10513434-10513531 [+]
mmu-mir-466nchr2: 10513741-10513834 [+]
mmu-mir-669ochr2: 10514300-10514395 [+]
mmu-mir-466gchr2: 10514595-10514674 [+]
mmu-mir-466hchr2: 10514891-10514971 [+]
mmu-mir-297a-3chr2: 10515820-10515921 [+]
mmu-mir-466lchr2: 10516097-10516217 [+]
mmu-mir-297a-4chr2: 10517067-10517164 [+]
mmu-mir-669ichr2: 10517604-10517730 [+]
mmu-mir-669hchr2: 10518155-10518279 [+]
Database links

Mature sequence mmu-miR-466n-5p

Accession MIMAT0014893
Sequence

19 - 

gugugugcguacauguacaugu

 - 40

Get sequence
Deep sequencing1792 reads, 77 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-466n-3p

Accession MIMAT0014894
Sequence

58 - 

uauacaugagagcauacauaga

 - 79

Get sequence
Deep sequencing576 reads, 65 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).