Stem-loop sequence mmu-mir-466p

AccessionMI0014078 (change log)
Symbol MGI:Mir466p
DescriptionMus musculus miR-466p stem-loop
Gene family MIPF0000208; mir-466
Literature search

22 open access papers mention mmu-mir-466p
(57 sentences)

Stem-loop
   u    --          -          ac     ca     g au 
5'  gugu  auauguguuu augugugugu  augua  ugugu a  a
    ||||  |||||||||| ||||||||||  |||||  ||||| |   
3'  cacg  uauacacaga uacacacgca  uacau  auaua u  u
   a    ag          a          ca     --     g ag 
Get sequence
Deep sequencing
26666 reads, 117 reads per million, 105 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10506006-10506094 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-466p
mmu-mir-466b-7chr2: 10496268-10496355 [+]
mmu-mir-669p-2chr2: 10496497-10496583 [+]
mmu-mir-467a-9chr2: 10498393-10498475 [+]
mmu-mir-466b-2chr2: 10498685-10498766 [+]
mmu-mir-669a-10chr2: 10498911-10498997 [+]
mmu-mir-669a-11chr2: 10501339-10501425 [+]
mmu-mir-467a-10chr2: 10503273-10503355 [+]
mmu-mir-466b-3chr2: 10503565-10503645 [+]
mmu-mir-669a-12chr2: 10503791-10503877 [+]
mmu-mir-467echr2: 10505721-10505807 [+]
mmu-mir-466pchr2: 10506006-10506094 [+]
mmu-mir-467dchr2: 10507630-10507714 [+]
mmu-mir-466achr2: 10507918-10507990 [+]
mmu-mir-297cchr2: 10509016-10509113 [+]
mmu-mir-669cchr2: 10509296-10509404 [+]
mmu-mir-669a-2chr2: 10510164-10510260 [+]
mmu-mir-297bchr2: 10511667-10511775 [+]
mmu-mir-466dchr2: 10511967-10512062 [+]
mmu-mir-669m-1chr2: 10512790-10512887 [+]
mmu-mir-669m-2chr2: 10513434-10513531 [+]
mmu-mir-466nchr2: 10513741-10513834 [+]
mmu-mir-669ochr2: 10514300-10514395 [+]
mmu-mir-466gchr2: 10514595-10514674 [+]
mmu-mir-466hchr2: 10514891-10514971 [+]
mmu-mir-297a-3chr2: 10515820-10515921 [+]
Database links

Mature sequence mmu-miR-466p-5p

Accession MIMAT0014891
Sequence

15 - 

uauguguguguacauguacau

 - 35

Get sequence
Deep sequencing4278 reads, 85 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-466p-3p

Accession MIMAT0014892
Sequence

54 - 

auacauacacgcacacauaaga

 - 75

Get sequence
Deep sequencing22372 reads, 102 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).