Stem-loop sequence mmu-mir-669a-12

AccessionMI0014077 (change log)
Symbol MGI:Mir669a-12
DescriptionMus musculus miR-669a-12 stem-loop
Gene family MIPF0000316; mir-467
Literature search

15 open access papers mention mmu-mir-669a-12
(22 sentences)

Stem-loop
   u    a     g    gu        c     c    c   au 
5'  gugc ugugu uaua  ugugugug auguu augu uau  u
    |||| ||||| ||||  |||||||| ||||| |||| |||   
3'  cacg acgca auau  acacacac uacaa uaca aua  u
   a    a     a    gc        a     -    u   ag 
Get sequence
Deep sequencing
98132 reads, 266 reads per million, 105 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10503791-10503877 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000179776 ; Mir669a-12-201; exon 1
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-669a-12
mmu-mir-466b-6chr2: 10493798-10493887 [+]
mmu-mir-669a-9chr2: 10494028-10494114 [+]
mmu-mir-467a-8chr2: 10495980-10496062 [+]
mmu-mir-466b-7chr2: 10496268-10496355 [+]
mmu-mir-669p-2chr2: 10496497-10496583 [+]
mmu-mir-467a-9chr2: 10498393-10498475 [+]
mmu-mir-466b-2chr2: 10498685-10498766 [+]
mmu-mir-669a-10chr2: 10498911-10498997 [+]
mmu-mir-669a-11chr2: 10501339-10501425 [+]
mmu-mir-467a-10chr2: 10503273-10503355 [+]
mmu-mir-466b-3chr2: 10503565-10503645 [+]
mmu-mir-669a-12chr2: 10503791-10503877 [+]
mmu-mir-467echr2: 10505721-10505807 [+]
mmu-mir-466pchr2: 10506006-10506094 [+]
mmu-mir-467dchr2: 10507630-10507714 [+]
mmu-mir-466achr2: 10507918-10507990 [+]
mmu-mir-297cchr2: 10509016-10509113 [+]
mmu-mir-669cchr2: 10509296-10509404 [+]
mmu-mir-669a-2chr2: 10510164-10510260 [+]
mmu-mir-297bchr2: 10511667-10511775 [+]
mmu-mir-466dchr2: 10511967-10512062 [+]
mmu-mir-669m-1chr2: 10512790-10512887 [+]
mmu-mir-669m-2chr2: 10513434-10513531 [+]
mmu-mir-466nchr2: 10513741-10513834 [+]
Database links

Mature sequence mmu-miR-669a-5p

Accession MIMAT0003477
Previous IDsmmu-miR-669a
Sequence

16 - 

aguugugugugcauguucaugucu

 - 39

Get sequence
Deep sequencing946140 reads, 103 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-669a-3p

Accession MIMAT0017243
Sequence

52 - 

acauaacauacacacacacguau

 - 74

Get sequence
Deep sequencing209132 reads, 101 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).