Stem-loop sequence mmu-mir-669p-2

AccessionMI0014071 (change log)
Symbol MGI:Mir669p-2
DescriptionMus musculus miR-669p-2 stem-loop
Gene family MIPF0000316; mir-467
Literature search

8 open access papers mention mmu-mir-669p-2
(11 sentences)

Stem-loop
       a     g    -  -        c     c    c   au 
5' gugc ugugu uaua gu ugugugug auguu augu uau  u
   |||| ||||| |||| || |||||||| ||||| |||| |||   
3' cacg acgca auau ca acacacac uacaa uaca aua  u
       a     a    g  c        a     -    u   ag 
Get sequence
Deep sequencing
95197 reads, 447 reads per million, 133 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10496497-10496583 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-669p-2
mmu-mir-669a-7chr2: 10486653-10486739 [+]
mmu-mir-467a-5chr2: 10488599-10488681 [+]
mmu-mir-466b-5chr2: 10488887-10488974 [+]
mmu-mir-669p-1chr2: 10489116-10489202 [+]
mmu-mir-467a-6chr2: 10491048-10491130 [+]
mmu-mir-466c-3chr2: 10491336-10491425 [+]
mmu-mir-669a-8chr2: 10491566-10491652 [+]
mmu-mir-467a-7chr2: 10493510-10493592 [+]
mmu-mir-466b-6chr2: 10493798-10493887 [+]
mmu-mir-669a-9chr2: 10494028-10494114 [+]
mmu-mir-467a-8chr2: 10495980-10496062 [+]
mmu-mir-466b-7chr2: 10496268-10496355 [+]
mmu-mir-669p-2chr2: 10496497-10496583 [+]
mmu-mir-467a-9chr2: 10498393-10498475 [+]
mmu-mir-466b-2chr2: 10498685-10498766 [+]
mmu-mir-669a-10chr2: 10498911-10498997 [+]
mmu-mir-669a-11chr2: 10501339-10501425 [+]
mmu-mir-467a-10chr2: 10503273-10503355 [+]
mmu-mir-466b-3chr2: 10503565-10503645 [+]
mmu-mir-669a-12chr2: 10503791-10503877 [+]
mmu-mir-467echr2: 10505721-10505807 [+]
mmu-mir-466pchr2: 10506006-10506094 [+]
Database links

Mature sequence mmu-miR-669p-5p

Accession MIMAT0014889
Previous IDsmmu-miR-669p
Sequence

15 - 

aguugugugugcauguucaugucu

 - 38

Get sequence
Deep sequencing157688 reads, 103 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-669p-3p

Accession MIMAT0014890
Previous IDsmmu-miR-669p*
Sequence

52 - 

cauaacauacacacacacacguau

 - 75

Get sequence
Deep sequencing32412 reads, 130 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).