Stem-loop sequence mmu-mir-466b-4

AccessionMI0014060 (change log)
Symbol MGI:Mir466b-4
DescriptionMus musculus miR-466b-4 stem-loop
Gene family MIPF0000208; mir-466
Literature search

27 open access papers mention mmu-mir-466b-4
(88 sentences)

Stem-loop
   u    --         -g          ac     c       aa 
5'  gugu  guauguguu  augugugugu  augua augugug  u
    ||||  |||||||||  ||||||||||  ||||| |||||||  a
3'  cacg  uauacacag  uacacacgca  uacau uacauau  u
   a    ag         aa          ca     a       ag 
Get sequence
Deep sequencing
31384 reads, 126 reads per million, 103 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10486423-10486512 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-466b-4
mmu-mir-466b-8chr2: 10476628-10476713 [+]
mmu-mir-669a-1chr2: 10476853-10476949 [+]
mmu-mir-669gchr2: 10477150-10477272 [+]
mmu-mir-669jchr2: 10477910-10478030 [+]
mmu-mir-467a-2chr2: 10478798-10478880 [+]
mmu-mir-466echr2: 10479088-10479171 [+]
mmu-mir-669a-4chr2: 10479315-10479401 [+]
mmu-mir-467bchr2: 10481248-10481320 [+]
mmu-mir-466c-1chr2: 10481534-10481617 [+]
mmu-mir-669a-5chr2: 10481761-10481847 [+]
mmu-mir-467a-3chr2: 10483678-10483760 [+]
mmu-mir-466c-2chr2: 10483966-10484055 [+]
mmu-mir-669a-6chr2: 10484196-10484282 [+]
mmu-mir-467a-4chr2: 10486135-10486217 [+]
mmu-mir-466b-4chr2: 10486423-10486512 [+]
mmu-mir-669a-7chr2: 10486653-10486739 [+]
mmu-mir-467a-5chr2: 10488599-10488681 [+]
mmu-mir-466b-5chr2: 10488887-10488974 [+]
mmu-mir-669p-1chr2: 10489116-10489202 [+]
mmu-mir-467a-6chr2: 10491048-10491130 [+]
mmu-mir-466c-3chr2: 10491336-10491425 [+]
mmu-mir-669a-8chr2: 10491566-10491652 [+]
mmu-mir-467a-7chr2: 10493510-10493592 [+]
mmu-mir-466b-6chr2: 10493798-10493887 [+]
mmu-mir-669a-9chr2: 10494028-10494114 [+]
mmu-mir-467a-8chr2: 10495980-10496062 [+]
mmu-mir-466b-7chr2: 10496268-10496355 [+]
Database links

Mature sequence mmu-miR-466b-5p

Accession MIMAT0004875
Sequence

14 - 

ugauguguguguacauguacau

 - 35

Get sequence
Deep sequencing63426 reads, 97 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-466b-3p

Accession MIMAT0004876
Sequence

55 - 

auacauacacgcacacauaaga

 - 76

Get sequence
Deep sequencing183579 reads, 102 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).