Stem-loop sequence mmu-mir-467a-2

AccessionMI0014053 (change log)
Symbol MGI:Mir467a-2
DescriptionMus musculus miR-467a-2 stem-loop
Gene family MIPF0000316; mir-467
Literature search

26 open access papers mention mmu-mir-467a-2
(105 sentences)

Stem-loop
   u    c      c   a   cc  c             ua 
5'  gugc ugugug gua gug  ug auguauaugcgug  u
    |||| |||||| ||| |||  || |||||||||||||  a
3'  cacg acacac cau cac  ac uacauauacguau  u
   a    u      a   c   ac  a             uu 
Get sequence
Deep sequencing
95781 reads, 392 reads per million, 112 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10478798-10478880 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-467a-2
mmu-mir-669lchr2: 10468971-10469068 [+]
mmu-mir-669d-2chr2: 10471644-10471729 [+]
mmu-mir-466f-3chr2: 10471953-10472046 [+]
mmu-mir-297a-2chr2: 10472254-10472343 [+]
mmu-mir-466ochr2: 10472540-10472623 [+]
mmu-mir-467cchr2: 10473931-10474027 [+]
mmu-mir-466b-1chr2: 10474219-10474300 [+]
mmu-mir-669a-3chr2: 10474433-10474541 [+]
mmu-mir-669kchr2: 10475300-10475426 [+]
mmu-mir-467a-1chr2: 10476346-10476418 [+]
mmu-mir-466b-8chr2: 10476628-10476713 [+]
mmu-mir-669a-1chr2: 10476853-10476949 [+]
mmu-mir-669gchr2: 10477150-10477272 [+]
mmu-mir-669jchr2: 10477910-10478030 [+]
mmu-mir-467a-2chr2: 10478798-10478880 [+]
mmu-mir-466echr2: 10479088-10479171 [+]
mmu-mir-669a-4chr2: 10479315-10479401 [+]
mmu-mir-467bchr2: 10481248-10481320 [+]
mmu-mir-466c-1chr2: 10481534-10481617 [+]
mmu-mir-669a-5chr2: 10481761-10481847 [+]
mmu-mir-467a-3chr2: 10483678-10483760 [+]
mmu-mir-466c-2chr2: 10483966-10484055 [+]
mmu-mir-669a-6chr2: 10484196-10484282 [+]
mmu-mir-467a-4chr2: 10486135-10486217 [+]
mmu-mir-466b-4chr2: 10486423-10486512 [+]
mmu-mir-669a-7chr2: 10486653-10486739 [+]
mmu-mir-467a-5chr2: 10488599-10488681 [+]
Database links

Mature sequence mmu-miR-467a-5p

Accession MIMAT0003409
Previous IDsmmu-miR-467*;mmu-miR-467a
Sequence

15 - 

uaagugccugcauguauaugcg

 - 36

Get sequence
Deep sequencing801150 reads, 101 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-467a-3p

Accession MIMAT0002108
Previous IDsmmu-miR-467;mmu-miR-467a;mmu-miR-467a*;mmu-miR-467a-1*;mmu-miR-467a*
Sequence

50 - 

cauauacauacacacaccuaca

 - 71

Get sequence
Deep sequencing156500 reads, 99 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).