Stem-loop sequence mmu-mir-466o

AccessionMI0014052 (change log)
Symbol MGI:Mir466o
DescriptionMus musculus miR-466o stem-loop
Gene family MIPF0000316; mir-467
Literature search

22 open access papers mention mmu-mir-466o
(56 sentences)

Stem-loop
   u    --         ga          --c     ---     g 
5'  gugu  guauguguu  ugugugugua   augua   caugu u
    ||||  |||||||||  ||||||||||   |||||   |||||  
3'  cacg  uauacacag  auacacacgu   uacau   guaua g
   a    ag         -a          aca     aua     a 
Get sequence
Deep sequencing
26594 reads, 118 reads per million, 102 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10472540-10472623 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-466o
mmu-mir-466mchr2: 10466663-10466746 [+]
mmu-mir-466f-1chr2: 10466944-10467037 [+]
mmu-mir-669fchr2: 10467229-10467349 [+]
mmu-mir-669echr2: 10467495-10467613 [+]
mmu-mir-669bchr2: 10467790-10467886 [+]
mmu-mir-669dchr2: 10468343-10468463 [+]
mmu-mir-466f-2chr2: 10468675-10468768 [+]
mmu-mir-669lchr2: 10468971-10469068 [+]
mmu-mir-669d-2chr2: 10471644-10471729 [+]
mmu-mir-466f-3chr2: 10471953-10472046 [+]
mmu-mir-297a-2chr2: 10472254-10472343 [+]
mmu-mir-466ochr2: 10472540-10472623 [+]
mmu-mir-467cchr2: 10473931-10474027 [+]
mmu-mir-466b-1chr2: 10474219-10474300 [+]
mmu-mir-669a-3chr2: 10474433-10474541 [+]
mmu-mir-669kchr2: 10475300-10475426 [+]
mmu-mir-467a-1chr2: 10476346-10476418 [+]
mmu-mir-466b-8chr2: 10476628-10476713 [+]
mmu-mir-669a-1chr2: 10476853-10476949 [+]
mmu-mir-669gchr2: 10477150-10477272 [+]
mmu-mir-669jchr2: 10477910-10478030 [+]
mmu-mir-467a-2chr2: 10478798-10478880 [+]
mmu-mir-466echr2: 10479088-10479171 [+]
mmu-mir-669a-4chr2: 10479315-10479401 [+]
mmu-mir-467bchr2: 10481248-10481320 [+]
mmu-mir-466c-1chr2: 10481534-10481617 [+]
mmu-mir-669a-5chr2: 10481761-10481847 [+]
Database links

Mature sequence mmu-miR-466o-5p

Accession MIMAT0014885
Sequence

14 - 

ugauguguguguacauguacau

 - 35

Get sequence
Deep sequencing7931 reads, 97 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-466o-3p

Accession MIMAT0014886
Sequence

50 - 

uacauacaugcacacauaagac

 - 71

Get sequence
Deep sequencing18657 reads, 100 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).