Stem-loop sequence mmu-mir-466m

AccessionMI0014050 (change log)
Symbol MGI:Mir466m
DescriptionMus musculus miR-466m stem-loop
Gene family MIPF0000316; mir-467
Literature search

24 open access papers mention mmu-mir-466m
(59 sentences)

Stem-loop
   u        u u        c     ca            aa 
5'  gugugugu c ugugugug augug  uguguguauaug  u
    |||||||| | |||||||| |||||  ||||||||||||   
3'  cacacaca g acgcacac uacac  acauacauauac  a
   a        u c        a     --            au 
Get sequence
Deep sequencing
13704 reads, 639 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10466663-10466746 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-466m
mmu-mir-466mchr2: 10466663-10466746 [+]
mmu-mir-466f-1chr2: 10466944-10467037 [+]
mmu-mir-669fchr2: 10467229-10467349 [+]
mmu-mir-669echr2: 10467495-10467613 [+]
mmu-mir-669bchr2: 10467790-10467886 [+]
mmu-mir-669dchr2: 10468343-10468463 [+]
mmu-mir-466f-2chr2: 10468675-10468768 [+]
mmu-mir-669lchr2: 10468971-10469068 [+]
mmu-mir-669d-2chr2: 10471644-10471729 [+]
mmu-mir-466f-3chr2: 10471953-10472046 [+]
mmu-mir-297a-2chr2: 10472254-10472343 [+]
mmu-mir-466ochr2: 10472540-10472623 [+]
mmu-mir-467cchr2: 10473931-10474027 [+]
mmu-mir-466b-1chr2: 10474219-10474300 [+]
mmu-mir-669a-3chr2: 10474433-10474541 [+]
mmu-mir-669kchr2: 10475300-10475426 [+]
mmu-mir-467a-1chr2: 10476346-10476418 [+]
mmu-mir-466b-8chr2: 10476628-10476713 [+]
Database links

Mature sequence mmu-miR-466m-5p

Accession MIMAT0014882
Sequence

15 - 

ugugugcaugugcauguguguau

 - 37

Get sequence
Deep sequencing1773 reads, 86 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-466m-3p

Accession MIMAT0014883
Sequence

51 - 

uacauacacacauacacacgca

 - 72

Get sequence
Deep sequencing11907 reads, 111 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).