Stem-loop sequence mmu-mir-3086

AccessionMI0014049 (change log)
Symbol MGI:Mir3086
DescriptionMus musculus miR-3086 stem-loop
Stem-loop
                              c      aag      c 
5' cugccauccuacacuuagauuguaggc cauugg   gguuag g
   ||||||||||||||||||||||||||| ||||||   ||||||  
3' ggcgguagggugugaaucugacauccg guaacc   ccaguu u
                              a      ---      c 
Get sequence
Deep sequencing
3029 reads, 1.43 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 58911673-58911759 [-]
intergenic
Database links

Mature sequence mmu-miR-3086-5p

Accession MIMAT0014880
Sequence

16 - 

uagauuguaggcccauugga

 - 35

Get sequence
Deep sequencing3009 reads, 67 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3086-3p

Accession MIMAT0014881
Sequence

53 - 

cccaaugagccuacagucuaag

 - 74

Get sequence
Deep sequencing17 reads, 10 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).