Stem-loop sequence mmu-mir-3080

AccessionMI0014043 (change log)
Symbol MGI:Mir3080
DescriptionMus musculus miR-3080 stem-loop
Literature search

1 open access papers mention mmu-mir-3080
(1 sentences)

Stem-loop
      -uu     c g      -c     uu   ucg    cc 
5' ggu   gagau u aagcgc  uguuc  gga   uggc  u
   |||   ||||| | ||||||  |||||  |||   ||||   
3' ccg   cucua a uucgcg  acggg  ccu   acug  g
      ugu     c g      aa     cu   ---    au 
Get sequence
Deep sequencing
44 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 82959218-82959296 [-]
intergenic
Database links

Mature sequence mmu-miR-3080-5p

Accession MIMAT0014868
Sequence

12 - 

ugaagcgccuguucuuggau

 - 31

Get sequence
Deep sequencing18 reads, 10 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3080-3p

Accession MIMAT0014869
Sequence

48 - 

uccucgggcaaagcgcuugaca

 - 69

Get sequence
Deep sequencing24 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).