Stem-loop sequence mmu-mir-3078

AccessionMI0014041 (change log)
Symbol MGI:Mir3078
DescriptionMus musculus miR-3078 stem-loop
Literature search

1 open access papers mention mmu-mir-3078
(4 sentences)

Stem-loop
     ug    a  g    -    c   ga  -      a  uu  a 
5' ac  gcag cu cccc aaag cua  cu gcagcu cc  gu u
   ||  |||| || |||| |||| |||  || |||||| ||  || u
3' ug  uguc ga gggg uuuc gau  gg cguugg gg  cg g
     uu    -  a    a    u   gg  u      -  uu  u 
Get sequence
Deep sequencing
234 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 64591185-64591271 [+]
sense
ENSMUST00000180610 ; A930011O12Rik-201; exon 2
ENSMUST00000181808 ; A930011O12Rik-202; exon 4
Clustered miRNAs
< 10kb from mmu-mir-3078
mmu-mir-124-1chr14: 64590657-64590741 [+]
mmu-mir-3078chr14: 64591185-64591271 [+]
Database links

Mature sequence mmu-miR-3078-5p

Accession MIMAT0014864
Previous IDsmmu-miR-3078
Sequence

16 - 

caaagccuagacugcagcuaccu

 - 38

Get sequence
Deep sequencing101 reads, 17 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3078-3p

Accession MIMAT0014865
Previous IDsmmu-miR-3078*
Sequence

55 - 

uugcugggguagucuuuagg

 - 74

Get sequence
Deep sequencing131 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).