Stem-loop sequence mmu-mir-3077

AccessionMI0014040 (change log)
Symbol MGI:Mir3077
DescriptionMus musculus miR-3077 stem-loop
Literature search

3 open access papers mention mmu-mir-3077
(10 sentences)

Stem-loop
          cg  ug  ----------     ag   a 
5' cugcgga  gg  gg          cgggc  gcc a
   |||||||  ||  ||          |||||  |||  
3' gacgccu  uc  cc          gcccg  cgg a
          cu  gu  cucagucgga     cg   u 
Get sequence
Deep sequencing
141 reads, 0 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 57798424-57798487 [+]
sense
OTTMUST00000053448 ; Sap18-001; intron 1
OTTMUST00000053451 ; Sap18-004; intron 1
OTTMUST00000053452 ; Sap18-005; 3'UTR (exon 1)
OTTMUST00000053453 ; Sap18-006; intron 1
ENSMUST00000128764 ; Sap18-001; intron 1
ENSMUST00000111269 ; Sap18-006; intron 1
ENSMUST00000131455 ; Sap18-004; intron 1
ENSMUST00000143600 ; Sap18-005; 3'UTR (exon 1)
Database links

Mature sequence mmu-miR-3077-5p

Accession MIMAT0014862
Previous IDsmmu-miR-3077*
Sequence

1 - 

cugcggacgggugggcgggcaggcc

 - 25

Get sequence
Deep sequencing36 reads, 18 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3077-3p

Accession MIMAT0014863
Previous IDsmmu-miR-3077
Sequence

43 - 

cugacucccugcuucuccgcag

 - 64

Get sequence
Deep sequencing104 reads, 38 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).