Stem-loop sequence mmu-mir-3074-1

AccessionMI0014037 (change log)
Symbol MGI:Mir3074-1
DescriptionMus musculus miR-3074-1 stem-loop
Gene family MIPF0001103; mir-3074
Literature search

5 open access papers mention mmu-mir-3074-1
(18 sentences)

Stem-loop
          -a    u  u        a    -gc    gugug 
5' gggcucg  cucc gu ccugcuga cuga   cagu     a
   |||||||  |||| || |||||||| ||||   ||||     a
3' ccugggc  gagg ca ggaugacu gacu   guca     a
          gg    c  c        c    aua    agagu 
Get sequence
Deep sequencing
1516 reads, 0 reads per million, 85 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 63301199-63301283 [-]
sense
ENSMUST00000175000 ; Mir3074-1-201; exon 1
antisense
OTTMUST00000076332 ; AC130827.2-002; intron 3
ENSMUST00000159152 ; 2010111I01Rik-002; intron 3
ENSMUST00000021911 ; 2010111I01Rik-201; intron 15
Clustered miRNAs
< 10kb from mmu-mir-3074-1
mmu-mir-24-1chr13: 63301208-63301275 [+]
mmu-mir-3074-1chr13: 63301199-63301283 [-]
mmu-mir-27bchr13: 63300712-63300784 [+]
mmu-mir-23bchr13: 63300484-63300557 [+]
Database links

Mature sequence mmu-miR-3074-5p

Accession MIMAT0014856
Sequence

14 - 

guuccugcugaacugagccagu

 - 35

Get sequence
Deep sequencing1576 reads, 57 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3074-1-3p

Accession MIMAT0014857
Sequence

52 - 

gauaucagcucaguaggcaccg

 - 73

Get sequence
Deep sequencing721 reads, 80 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).