Stem-loop sequence mmu-mir-3072

AccessionMI0014035 (change log)
Symbol MGI:Mir3072
DescriptionMus musculus miR-3072 stem-loop
Gene family MIPF0001410; mir-3072
Literature search

4 open access papers mention mmu-mir-3072
(18 sentences)

Stem-loop
         uu     c     -ac  c ag  a       cu     
5' gggcug  gagug gaggg   cc g  gg gggcagg  gccc 
   ||||||  ||||| |||||   || |  || |||||||  ||| c
3' cccgac  cucgu cuucc   gg c  cc cccgucc  cgga 
         --     u     gaa  a cu  -       --     
Get sequence
Deep sequencing
1675 reads, 30 reads per million, 60 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109747878-109747960 [+]
sense
OTTMUST00000113371 ; Mirg-007; intron 1
OTTMUST00000113372 ; Mirg-003; exon 1
OTTMUST00000113367 ; Mirg-001; intron 6
OTTMUST00000113368 ; Mirg-005; intron 6
OTTMUST00000114051 ; Mirg-010; intron 10
OTTMUST00000114052 ; Mirg-009; intron 13
OTTMUST00000114049 ; Mirg-011; intron 15
ENSMUST00000183068 ; Mirg-007; intron 1
ENSMUST00000183084 ; Mirg-003; exon 1
ENSMUST00000181543 ; Mirg-001; intron 6
ENSMUST00000183116 ; Mirg-005; intron 6
ENSMUST00000182185 ; Mirg-010; intron 10
ENSMUST00000182499 ; Mirg-009; intron 13
ENSMUST00000183144 ; Mirg-011; intron 15
Clustered miRNAs
< 10kb from mmu-mir-3072
mmu-mir-154chr12: 109738433-109738498 [+]
mmu-mir-496achr12: 109739119-109739197 [+]
mmu-mir-377chr12: 109740510-109740577 [+]
mmu-mir-541chr12: 109742409-109742498 [+]
mmu-mir-409chr12: 109743158-109743236 [+]
mmu-mir-412chr12: 109743289-109743368 [+]
mmu-mir-369chr12: 109743418-109743496 [+]
mmu-mir-410chr12: 109743715-109743795 [+]
mmu-mir-3072chr12: 109747878-109747960 [+]
Database links

Mature sequence mmu-miR-3072-5p

Accession MIMAT0014852
Previous IDsmmu-miR-3072*
Sequence

16 - 

agggaccccgagggagggcagg

 - 37

Get sequence
Deep sequencing555 reads, 44 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence mmu-miR-3072-3p

Accession MIMAT0014853
Previous IDsmmu-miR-3072
Sequence

51 - 

ugcccccuccaggaagccuucu

 - 72

Get sequence
Deep sequencing1113 reads, 51 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).