Stem-loop sequence mmu-mir-3070-2

AccessionMI0014033 (change log)
Previous IDsmmu-mir-3070b
DescriptionMus musculus miR-3070-2 stem-loop
Gene family MIPF0001172; mir-3070
Stem-loop
   gugc   g     -cuga          -uuga   -u      cuc 
5'     uga ugagg     gccccugacc     acc  gggauc   c
       ||| |||||     ||||||||||     |||  ||||||    
3'     acu guucc     uggggacugg     ugg  uucuag   c
   ---u   -     uuaga          uaucg   uc      uac 
Get sequence
Deep sequencing
490 reads, 0 reads per million, 26 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109588592-109588680 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-3070-2
mmu-mir-493chr12: 109580233-109580315 [+]
mmu-mir-337chr12: 109585789-109585885 [+]
mmu-mir-3544chr12: 109585813-109585873 [-]
mmu-mir-540chr12: 109586080-109586146 [+]
mmu-mir-665chr12: 109586314-109586407 [+]
mmu-mir-3070-1chr12: 109587943-109588031 [+]
mmu-mir-3070-2chr12: 109588592-109588680 [+]
mmu-mir-431chr12: 109590447-109590537 [+]
mmu-mir-433chr12: 109591715-109591838 [+]
mmu-mir-127chr12: 109592846-109592915 [+]
mmu-mir-434chr12: 109594506-109594599 [+]
mmu-mir-432chr12: 109594956-109595030 [+]
mmu-mir-3071chr12: 109595318-109595397 [-]
mmu-mir-136chr12: 109595327-109595388 [+]
Database links

Mature sequence mmu-miR-3070-5p

Accession MIMAT0014846
Previous IDsmmu-miR-3070a-5p
Sequence

17 - 

agccccugaccuugaaccuggga

 - 39

Get sequence
Deep sequencing151 reads, 13 experiments
Evidence experimental; Illumina [1]

Mature sequence mmu-miR-3070-2-3p

Accession MIMAT0014849
Previous IDsmmu-miR-3070b-3p
Sequence

57 - 

uggugcuauggucagggguaga

 - 78

Get sequence
Deep sequencing414 reads, 21 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).