Stem-loop sequence mmu-mir-1251

AccessionMI0014021 (change log)
Symbol MGI:Mir1251
DescriptionMus musculus miR-1251 stem-loop
Gene family MIPF0000621; mir-1251
Literature search

4 open access papers mention mmu-mir-1251
(6 sentences)

Stem-loop
        -      gg  u  a    cca         --c  c 
5' gucag cuaugu  ac cu gcug   aaggcgcuu   uc u
   ||||| ||||||  || || ||||   |||||||||   || u
3' uaguc gguaca  ug ga cgac   uuucgcgag   ag c
        c      ga  u  c    ucg         aca  u 
Get sequence
Deep sequencing
1784 reads, 7.5 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 92137140-92137223 [-]
sense
OTTMUST00000113038 ; Rmst-004; intron 1
OTTMUST00000113033 ; Rmst-002; intron 2
OTTMUST00000113035 ; Rmst-007; intron 2
OTTMUST00000113037 ; Rmst-005; intron 2
OTTMUST00000113034 ; Rmst-001; intron 3
OTTMUST00000113036 ; Rmst-008; intron 3
ENSMUST00000182318 ; Rmst-004; intron 1
ENSMUST00000182033 ; Rmst-002; intron 2
ENSMUST00000183123 ; Rmst-007; intron 2
ENSMUST00000182005 ; Rmst-005; intron 2
ENSMUST00000181604 ; Rmst-001; intron 3
ENSMUST00000182567 ; Rmst-008; intron 3
Database links

Mature sequence mmu-miR-1251-5p

Accession MIMAT0014824
Previous IDsmmu-miR-1251
Sequence

14 - 

acucuagcugccaaaggcgcu

 - 34

Get sequence
Deep sequencing1698 reads, 37 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-1251-3p

Accession MIMAT0014825
Previous IDsmmu-miR-1251*
Sequence

52 - 

cgcuuugcucagccaguguag

 - 72

Get sequence
Deep sequencing78 reads, 12 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).