Stem-loop sequence mmu-mir-3057

AccessionMI0014020 (change log)
Symbol MGI:Mir3057
DescriptionMus musculus miR-3057 stem-loop
Literature search

1 open access papers mention mmu-mir-3057
(1 sentences)

Stem-loop
   -u  a   g     auug      a auu   c    u    uagga 
5'   ga ggu ugugc    gagcug g   cug ggga ggau     g
     || ||| |||||    |||||| |   ||| |||| ||||      
3'   cu ccg acacg    cucgac c   gac cccu ccug     u
   gg  a   a     -aua      c --g   a    -    uuaua 
Get sequence
Deep sequencing
3203 reads, 2.08 reads per million, 96 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 81271597-81271687 [+]
sense
ENSMUST00000057798 ; Apba3-201; 3'UTR (exon 7)
Database links

Mature sequence mmu-miR-3057-5p

Accession MIMAT0014822
Sequence

14 - 

auuggagcugagauucugcgggau

 - 37

Get sequence
Deep sequencing3090 reads, 90 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3057-3p

Accession MIMAT0014823
Sequence

58 - 

ucccacaggcccagcucauagc

 - 79

Get sequence
Deep sequencing113 reads, 50 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).