Stem-loop sequence api-mir-9b

AccessionMI0013955 (change log)
DescriptionAcyrthosiphon pisum miR-9b stem-loop
Literature search

1 open access papers mention api-mir-9b
(1 sentences)

Stem-loop
   --ucu       uuu    g    uaua   u 
5'      uugguac   agcu uagg    uuu a
        |||||||   |||| ||||    |||  
3'      aaccaug   ucga aucc    gag a
   auugu       ucu    a    cgca   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350203.1: 471721-471784 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-9b
api-mir-9bGL350203.1: 471721-471784 [+]
api-mir-306GL350203.1: 472830-472890 [+]
Database links

Mature sequence api-miR-9b

Accession MIMAT0014749
Sequence

1 - 

ucuuugguacuuuagcuguag

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).