Stem-loop sequence api-mir-971

AccessionMI0013949 (change log)
Previous IDsapi-mir-971-1
DescriptionAcyrthosiphon pisum miR-971 stem-loop
Gene family MIPF0000995; mir-971
Literature search

2 open access papers mention api-mir-971
(3 sentences)

Stem-loop
   --    u    u             cucag 
5'   cacu uaag uugagcaccaagc     g
     |||| |||| |||||||||||||      
3'   guga auuc aacuugugguuug     c
   ga    c    c             uuauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350500.1: 197684-197743 [+]
intergenic
Database links

Mature sequence api-miR-971

Accession MIMAT0014745
Sequence

38 - 

uugguguucaaccuuacagugag

 - 60

Get sequence
Evidence experimental;

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).