Stem-loop sequence api-mir-317

AccessionMI0013934 (change log)
DescriptionAcyrthosiphon pisum miR-317 stem-loop
Literature search

3 open access papers mention api-mir-317
(4 sentences)

Stem-loop
   ---a   -  -        a    gucaug  auu    ua 
5'     acc uc gcuguguu acuu      uu   ucga  a
       ||| || |||||||| ||||      ||   ||||  u
3'     ugg gg cgacacaa ugag      aa   agcu  u
   ucua   u  u        g    --acua  -gu    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349754.1: 848266-848342 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-317
api-mir-317GL349754.1: 848266-848342 [+]
api-mir-277GL349754.1: 855885-855963 [+]
Database links

Mature sequence api-miR-317

Accession MIMAT0014732
Sequence

57 - 

ugaacacagcuggugguaucu

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).