Stem-loop sequence api-mir-2c

AccessionMI0013929 (change log)
DescriptionAcyrthosiphon pisum miR-2c stem-loop
Gene family MIPF0000049; mir-2
Literature search

3 open access papers mention api-mir-2c
(7 sentences)

Stem-loop
   ---c         g      c    agugu   uu 
5'     cgucaaagc ggcugu guag     uca  u
       ||||||||| |||||| ||||     |||  u
3'     guaguuucg ccgaca uauc     agu  c
   acga         a      c    -----   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349742.1: 367625-367689 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-2c
api-mir-71GL349742.1: 367510-367571 [+]
api-mir-2cGL349742.1: 367625-367689 [+]
api-mir-13aGL349742.1: 367742-367802 [+]
api-mir-2aGL349742.1: 368362-368423 [+]
api-mir-2bGL349742.1: 368487-368567 [+]
Database links

Mature sequence api-miR-2c

Accession MIMAT0014728
Sequence

1 - 

ccgucaaagcgggcugucgua

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).