Stem-loop sequence api-mir-2b

AccessionMI0013928 (change log)
DescriptionAcyrthosiphon pisum miR-2b stem-loop
Gene family MIPF0000049; mir-2
Literature search

3 open access papers mention api-mir-2b
(8 sentences)

Stem-loop
   --     -     -         a   -uuc     uucauu 
5'   cucgu caaag ugguuguga acg    ugguu      u
     ||||| ||||| ||||||||| |||    |||||       
3'   gagua guuuc accgacacu ugc    auuaa      u
   ac     u     g         a   uaua     cuuaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349742.1: 368487-368567 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-2b
api-mir-71GL349742.1: 367510-367571 [+]
api-mir-2cGL349742.1: 367625-367689 [+]
api-mir-13aGL349742.1: 367742-367802 [+]
api-mir-2aGL349742.1: 368362-368423 [+]
api-mir-2bGL349742.1: 368487-368567 [+]
Database links

Mature sequence api-miR-2b

Accession MIMAT0014821
Sequence

57 - 

uaucacagccagcuuuguaugagca

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).