Stem-loop sequence api-mir-29

AccessionMI0013926 (change log)
DescriptionAcyrthosiphon pisum miR-29 stem-loop
Gene family MIPF0000009; mir-29
Literature search

1 open access papers mention api-mir-29
(1 sentences)

Stem-loop
   --        uau      a    ---ag   ua 
5'   ugguuucg   uggugc uaga     uau  a
     ||||||||   |||||| ||||     |||  u
3'   accaaagu   accacg aucu     aug  u
   ug        -uu      -    guuca   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350634.1: 49544-49607 [+]
intergenic
Database links

Mature sequence api-miR-29

Accession MIMAT0014726
Sequence

45 - 

uagcaccauuugaaaccagu

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).