Stem-loop sequence api-mir-210

AccessionMI0013915 (change log)
Previous IDsapi-mir-210-1
DescriptionAcyrthosiphon pisum miR-210 stem-loop
Gene family MIPF0000086; mir-210
Literature search

1 open access papers mention api-mir-210
(1 sentences)

Stem-loop
   --       ug  aca       
5'   uugugcg  ug   ucggcu 
     |||||||  ||   ||||| a
3'   aauacgc  gu   ggcugu 
   uc       gu  --g       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350019.1: 289988-290028 [+]
intergenic
Database links

Mature sequence api-miR-210

Accession MIMAT0014716
Sequence

1 - 

uugugcgugugacaucggcua

 - 21

Get sequence
Evidence experimental;

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).