Stem-loop sequence api-mir-184b

AccessionMI0013914 (change log)
DescriptionAcyrthosiphon pisum miR-184b stem-loop
Gene family MIPF0000059; mir-184
Literature search

1 open access papers mention api-mir-184b
(1 sentences)

Stem-loop
   --        -       g   ---u        
5'   cuuuauca uucucug ucu    gugugaa 
     |||||||| ||||||| |||    |||||| u
3'   gaaauagu aagaggc agg    cauauuu 
   ag        c       -   ucau        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350175.1: 151852-151911 [+]
intergenic
Database links

Mature sequence api-miR-184b

Accession MIMAT0014715
Sequence

39 - 

uggacggagaacugauaaagga

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).