Stem-loop sequence api-mir-13a

AccessionMI0013912 (change log)
DescriptionAcyrthosiphon pisum miR-13a stem-loop
Gene family MIPF0000049; mir-2
Literature search

1 open access papers mention api-mir-13a
(1 sentences)

Stem-loop
   --c       a   a     a    uuuuu 
5'    cgucaaa ugg uguga gugg     u
      ||||||| ||| ||||| ||||     u
3'    guaguuu acc acacu uacu     u
   cga       c   g     a    uauca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349742.1: 367742-367802 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-13a
api-mir-71GL349742.1: 367510-367571 [+]
api-mir-2cGL349742.1: 367625-367689 [+]
api-mir-13aGL349742.1: 367742-367802 [+]
api-mir-2aGL349742.1: 368362-368423 [+]
api-mir-2bGL349742.1: 368487-368567 [+]
Database links

Mature sequence api-miR-13a

Accession MIMAT0014713
Sequence

40 - 

uaucacagccacuuugaugagc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).