Stem-loop sequence api-mir-124

Accession

MI0013911

Description

Acyrthosiphon pisum miR-124 stem-loop

Gene family

MIPF0000021; mir-124

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation.

Stem-loop

--           u a    a    uug  a 
  gcguucacugu g gccu uaug   uu a
  ||||||||||| | |||| ||||   || u
  cguaaguggcg c cgga auac   ag a
ac           - a    -    -ua  u 

Genome context

• Coordinates (AphidBase2): GL350151.1: 56406-56465 [-]
• Overlapping transcripts:

  intergenic

Database links

• ENTREZGENE: 100631041;Mir124

Mature sequence api-miR-124

• Accession: MIMAT0014712
• Sequence: 40 - uaaggcacgcggugaaugcca - 60
• Evidence: experimental; Solexa [1]

References

1. PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).