|
miRBase |
|
Stem-loop sequence hsv1-mir-H18 |
|
| Accession | MI0013892 |
| Description | Herpes Simplex Virus 1 miR-H18 stem-loop |
| Stem-loop |
a cc accaa g c c cggucccgcccgccgg cg ggg cgg a ggcgggcggcc a |||||||||||||||| || ||| ||| | ||||||||||| gccagggcgggcggcc gu ccc gcc u ccgcccgccgg a g ua -cccc g u g |
Mature sequence hsv1-miR-H18 |
|
| Accession | MIMAT0014696 |
| Sequence |
5 - cccgcccgccggacgccgggacc - 27 |
| Evidence | experimental; Solexa [1] |
References |
|
| 1 |
PMID:20181707
"Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2"
J Virol. 84:4659-4672(2010).
|