Stem-loop sequence hsv1-mir-H18

AccessionMI0013892
DescriptionHerpes Simplex Virus 1 miR-H18 stem-loop
Stem-loop
                a  cc   accaa   g c           c 
cggucccgcccgccgg cg  ggg     cgg a ggcgggcggcc a
|||||||||||||||| ||  |||     ||| | |||||||||||  
gccagggcgggcggcc gu  ccc     gcc u ccgcccgccgg a
                g  ua   -cccc   g u           g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence hsv1-miR-H18

Accession MIMAT0014696
Sequence

5 - 

cccgcccgccggacgccgggacc

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).