Stem-loop sequence hsv1-mir-H17

AccessionMI0013891
DescriptionHerpes Simplex Virus 1 miR-H17 stem-loop
Stem-loop
    cacu   a        g     g ug g   -------     g   c 
ggcc    cgc cgccgccu cgcgc c  g gcc       ugggc cgc g
||||    ||| |||||||| ||||| |  | |||       ||||| |||  
ccgg    gcg guggcgga gcgcg g  c cgg       gcccg gcg c
    --cc   c        -     g gu g   ugcaugu     -   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence hsv1-miR-H17

Accession MIMAT0014695
Sequence

63 - 

uggcgcuggggcgcgaggcgg

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).